View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_28 (Length: 289)
Name: NF17108_low_28
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 28 - 122
Target Start/End: Complemental strand, 304333 - 304239
Alignment:
| Q |
28 |
gtatgggttgatattctgttgtaataataatacaacattgatgtttcagtctaactctaatcatttatgaataaaatcatgatcatctgttttaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304333 |
gtatgggttgatattctgttgtaataataatacaacattgatgtttcagtctaactctaatcatttatgaataaaatcatgatcatctgttttaa |
304239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 304126 - 304027
Alignment:
| Q |
187 |
atggaatagtctccaatggacaaaattaagattataattcaacatgtaatgc------------cattcaattatatcaaagaaaataacactactaaat |
274 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
304126 |
atggaatagtctccaatggaccaaattaagattataattcaacatgtaatgcatagtgttgtttcattcaattatataaaagaaaataacactactaaat |
304027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 131 - 173
Target Start/End: Complemental strand, 304211 - 304169
Alignment:
| Q |
131 |
atcgaagattaacagatcactagagacagcgaaatacttccta |
173 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
304211 |
atcgaagattaacagatcactagagacagagaaatacttccta |
304169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University