View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_29 (Length: 289)
Name: NF17108_low_29
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 28733577 - 28733306
Alignment:
| Q |
1 |
gaatcttaacaaagattgttaagggatctcgtgggattgaagatttgaagtacttaggtgttaagttcgtggatcttgggcttggatcaagtcaaaggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
28733577 |
gaatcttaacaaagattgttaagggatctcgtgggattgaagatttgaagtacttaggtgttaagttcgtggatcttggacttggatcaagtcaaaagct |
28733478 |
T |
 |
| Q |
101 |
ttgttaattacttctaataaaaccatgtagtacattgtgcaaacactcaatcatagtagaaggccnnnnnnnnnttctacaaagagtggatataccccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28733477 |
ttgttaattacttctaataaaaccatgtagtacattgtgcaaacactcaatcatagtagaaggcc-aaaaaaaattctacaaagagtggatataccccat |
28733379 |
T |
 |
| Q |
201 |
aacgaggacgatttgggaaaccactatatattcagtgtattcttctcccttaccttttaatttccacaagttt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
28733378 |
aacgaggacgatttgggaaaccactataaattcggtgtattcttctcccttacctttgaatttctgcaagttt |
28733306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University