View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_34 (Length: 273)
Name: NF17108_low_34
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 65 - 260
Target Start/End: Complemental strand, 303927 - 303732
Alignment:
| Q |
65 |
cataaaagagttgaaatattattatagttgagcaagttggtgaatgttgataggataaacaaaattggtattgccattaaaagccatccttcccataaga |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303927 |
catagaagagttgaaatattattatagttgagcaagttggtgaatgttgataggataaacaaaattggtattgccattaaaagccatccttcccataaga |
303828 |
T |
 |
| Q |
165 |
atgttaactgcttctgttggatgaaatgcatcccaaaacacataacggtttctattagggcatggagtttggaatggtagacaagttatttgacct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303827 |
atgttaactgcttctgttggatgaaatgcatcccaaaacacataacggtttctattagggcatggagtttggaatggtagacaagttatttgacct |
303732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 304033 - 303968
Alignment:
| Q |
1 |
actaaatccatatcatcgatcatatgacaattttaattggaaatcaagctaggaagcaatacacca |
66 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304033 |
actaaatccatatcatcgattatatgacaattttaattggaaatcaagctaggaagcaatacacca |
303968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University