View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_40 (Length: 250)
Name: NF17108_low_40
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 24 - 237
Target Start/End: Complemental strand, 303620 - 303407
Alignment:
| Q |
24 |
attgatatatgctattttatgttagattcataccatatgatcttgcattgaaaagaatttcctgaaacatgcgggaactgtcaatgaatatgaatctgga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
303620 |
attgatatatgctattttatgttagattcataccatatgatcttgcattgaaaagaatttcctgaaacatgcgggaactgtcaatgaaaatgaatctgga |
303521 |
T |
 |
| Q |
124 |
accaggtagattattgttgagattgctcaacatagccttcacattttcattgaagggttgcactagcatgttcacttgttcagagcagcttccactcatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303520 |
accaggtagattattgttgagattgctcaacataaccttcacattttcattgaagggttgcactagcatgttcacttgttcagagcagcttccactcatg |
303421 |
T |
 |
| Q |
224 |
ctttgagacaatat |
237 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
303420 |
ctttgagacaatat |
303407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University