View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_41 (Length: 249)
Name: NF17108_low_41
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_41 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 2997696 - 2997461
Alignment:
| Q |
13 |
aaaattaattccttcatatattggtataaataaaacagaaaaaatctttcattaaatannnnnnnncatgctgcttgtcacttctctgttaaaggaacgg |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||| ||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
2997696 |
aaaattaattccttcgtatattggtataaataaaacggaaaaaaaatttcattaatt-ttttttttcatgctgcttgtcacttctctgttaaaggaacgg |
2997598 |
T |
 |
| Q |
113 |
aagcatacaagaactagagcagatttgaacttaccttatgcgatctctaccacaaattgcgtatctagttattatttctaacatttattcttttattagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2997597 |
aagcatacaagaactagagcagatttgaacttaccttatgcgatctctaccacaaattgcatatctagttattatttctaacatttattcttttattagg |
2997498 |
T |
 |
| Q |
213 |
tgaaatacatgcgagtcacaccagtttgagatggaaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2997497 |
tgaaatacatgcgagtcacaccagtttgagatggaaa |
2997461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 32160589 - 32160529
Alignment:
| Q |
182 |
tattatttctaacatttattcttttattaggtgaaatacatgcgagtcacaccagtttgaga |
243 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||| | || |||||| ||||||| |
|
|
| T |
32160589 |
tattattt-taacatttattcttttattaggtgaaatgtatgtgggttacaccattttgaga |
32160529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University