View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17108_low_52 (Length: 206)
Name: NF17108_low_52
Description: NF17108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17108_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 1207010 - 1207188
Alignment:
| Q |
3 |
gcgtgtttgtatttgcgcctttacttcacaccatttccattcaacatgaggttgatgttcgtttgaaacatttaagatcttttatcatttttaataactc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1207010 |
gcgtgtttgtatttgcgcctttacttcaaatcatttccattcaacatgaggttgatgttcgtttgaaacatttaagatcttttatcatttttaataactc |
1207109 |
T |
 |
| Q |
103 |
tttgtgtttgaacgaattcagttactgtggtaatcatgtaccacaaaccattatttattttaccgttcacatgcgatgcttct |
185 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1207110 |
tctgtgtttgaacgaattcagttactgtggtaatcatgtaccacaaacca----ttattttaccgttcacatgcgatgcttct |
1207188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University