View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1710_high_19 (Length: 243)
Name: NF1710_high_19
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1710_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 38120753 - 38120969
Alignment:
| Q |
14 |
caaatgtgatattattattgtgtcttatttatactaaaggagttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggtta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120753 |
caaatgtgatattattattgtgtcttatttatactaaaggagttggtttcggttcagcttcaacttctttgttaagttaccgttttgcaattgaaggtta |
38120852 |
T |
 |
| Q |
114 |
gccaccaatcatattcatcatgatatcacacttactataaatagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38120853 |
gccaccaatcatattcatcatgatatcacacttactataaatagaatcatgctatctttctctttaaccaaacactttaccctcttcattatctttggtt |
38120952 |
T |
 |
| Q |
214 |
acttcacactgtttttc |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38120953 |
acttcacactgtttttc |
38120969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University