View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1710_low_10 (Length: 332)
Name: NF1710_low_10
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1710_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 104 - 318
Target Start/End: Original strand, 41434583 - 41434798
Alignment:
| Q |
104 |
ttgcaagttgaaagctgctcacaaaattttaacgaaagtttagttatc-gactaattagaaaccactttcaataaccatgcaggggtcgatagaatttaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41434583 |
ttgcaagttgaaagctgctcacaaaattttaacgaaagtttagttatctgactaattagaaaccactttcaataaccatgtaggggtcgatagaatttaa |
41434682 |
T |
 |
| Q |
203 |
aaatacaaatccatgcatacgcagttaatttcctttcatgtaggatttgtgccaaaagttaagaaaaatcgaaatgtataaaaacgttaggtagtgtatg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41434683 |
aaatacaaatccatgcatacgcagttaatttcctttcatgtaggatttgtgccaaaagttaagaaaaatcgaaatgtataaaaacgttaggtagggtatg |
41434782 |
T |
 |
| Q |
303 |
tttggatggtcttttg |
318 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
41434783 |
tttggatgttcttttg |
41434798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 41434482 - 41434518
Alignment:
| Q |
3 |
agcacagatcacctatcgaatttaatagtccaatata |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41434482 |
agcacagatcacctatcgaatttaatagtccaatata |
41434518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University