View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1710_low_23 (Length: 237)
Name: NF1710_low_23
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1710_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 6824045 - 6824252
Alignment:
| Q |
18 |
gcatattgaagagcacctacaatagatatgaagatggaaggattctcaagataatccgcccaaactttgacaattttaagttggaaataatgggagtgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6824045 |
gcatattgaagagcacctacaatagatatgaagatggaaggatcctcaagataatccgcccaaactttgacaattttaagttggaaataatgggagtgac |
6824144 |
T |
|
| Q |
118 |
aatttattttgcatcagtcttatttggccatgtcaagaaatcacaaatgagcatagattgctttatacaatttgcacactagagatttatcttctaatcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6824145 |
aatttattttgcatcagtcttatttggccatgtcaagaaatcacaaatgagcatagattgctttatacaatttgcacactagagatttatcttctaatcc |
6824244 |
T |
|
| Q |
218 |
aaagccta |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
6824245 |
aaagccta |
6824252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 225
Target Start/End: Complemental strand, 6854397 - 6854341
Alignment:
| Q |
169 |
catagattgctttatacaatttgcacactagagatttatcttctaatccaaagccta |
225 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6854397 |
cataaattgctttatacaatttgcacactagagatttatcttttaatccaaagccta |
6854341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University