View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1710_low_24 (Length: 236)
Name: NF1710_low_24
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1710_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32686373 - 32686593
Alignment:
| Q |
1 |
aatcaactagttttttcaggaacaacctttgatcctgacaatttttggcatctttacacagccagcttgctttggtccatcaccatctgttgcaaaaccc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32686373 |
aatcaactagttttttcaggatcaacctttgatcctgacaatttttggcatctttacacagccagcttgctttggtccatcaccatctgttgcaaaaacc |
32686472 |
T |
 |
| Q |
101 |
ccctgctttatagtgaaaacaaccatattgaaatttatgcaaagtggtatccacctctttctatcttaacattgatattggttctcattacagtgtcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32686473 |
ccctgctttatagtgaaaacaaccatattgaaatttatgcaaagtggtatccacctctttctatcttaacattgatattggttctcattacagtgtcaat |
32686572 |
T |
 |
| Q |
201 |
ggccttttagcgtgtagaagc |
221 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
32686573 |
ggccttttagcgtttagaagc |
32686593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University