View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1710_low_28 (Length: 222)

Name: NF1710_low_28
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1710_low_28
NF1710_low_28
[»] chr2 (1 HSPs)
chr2 (17-209)||(42671651-42671852)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 42671852 - 42671651
Alignment:
17 atatgttacatatgtttttcgttaaggaatatgttacatatgttgacgacgagatttttgcaacatgcattgacga---------ctatttttggtggga 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||         |||||||||||||||    
42671852 atatgttacatatgtttttcgttaaggaatatgttacatatgttgacgacgagatttttgtaacatgcattgacgattcttttaactatttttggtggga 42671753  T
108 ataacaaatcaaaatagattataccagaaaggattaacaactatttgttacaaacatcttcatacagttttacaaatacaaattaattgaccattctctg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42671752 ataacaaatcaaaatagattataccagaaaggattaacaactatttgttacaaacatcttcatacagttttacaaatacaaattaattgaccattctctg 42671653  T
208 ct 209  Q
    ||    
42671652 ct 42671651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University