View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1710_low_28 (Length: 222)
Name: NF1710_low_28
Description: NF1710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1710_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 42671852 - 42671651
Alignment:
| Q |
17 |
atatgttacatatgtttttcgttaaggaatatgttacatatgttgacgacgagatttttgcaacatgcattgacga---------ctatttttggtggga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
42671852 |
atatgttacatatgtttttcgttaaggaatatgttacatatgttgacgacgagatttttgtaacatgcattgacgattcttttaactatttttggtggga |
42671753 |
T |
 |
| Q |
108 |
ataacaaatcaaaatagattataccagaaaggattaacaactatttgttacaaacatcttcatacagttttacaaatacaaattaattgaccattctctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42671752 |
ataacaaatcaaaatagattataccagaaaggattaacaactatttgttacaaacatcttcatacagttttacaaatacaaattaattgaccattctctg |
42671653 |
T |
 |
| Q |
208 |
ct |
209 |
Q |
| |
|
|| |
|
|
| T |
42671652 |
ct |
42671651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University