View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17111_low_4 (Length: 212)
Name: NF17111_low_4
Description: NF17111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17111_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 2930605 - 2930428
Alignment:
| Q |
18 |
ggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcagggagttttccggcgaggagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930605 |
ggttttaagaggaaggctttgggatttcagtatgaggaagagaatatgattgaaattgatatttctccgacgaagcgcagggagttttccggcgaggagg |
2930506 |
T |
|
| Q |
118 |
aggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930505 |
aggtgtttgccggtgagattagttgcaactaatgtgagatttaggaaggattgacatagtgtattactatcatgtgat |
2930428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Original strand, 36117578 - 36117626
Alignment:
| Q |
42 |
tttcagtatgaggaagagaatatgattgaaattgatatttctccgacga |
90 |
Q |
| |
|
|||||||| || ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36117578 |
tttcagtacgaagaagagaatttgattgagattgatatttctccgacga |
36117626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University