View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_high_23 (Length: 264)
Name: NF17112_high_23
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 153
Target Start/End: Complemental strand, 33490019 - 33489881
Alignment:
| Q |
15 |
ctttatgtgaaaaaaccatgaattctcaattaaaattgattttgactataaaatttgcagcttttatctttataaatgttttttattgttcaactcgtat |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33490019 |
ctttatgtgaaaagaccatgaattctcaattaaaattgattttgactataaaatttgcagcttttatctttataaatgttttttattgttcaactcgtat |
33489920 |
T |
|
| Q |
115 |
aaatgatttttattgatcaactcattttatgtaaacata |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489919 |
aaatgatttttattgatcaactcattttatgtaaacata |
33489881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 147 - 240
Target Start/End: Complemental strand, 33489368 - 33489275
Alignment:
| Q |
147 |
aaacataagttcgattcttaaactaatcagttcttgatcgaactttannnnnnncttaggcgaacttcatattatagggatagatcctttatga |
240 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33489368 |
aaacctaagttcaattcttaaactaatcagttcttgatcgaactttatatttttcttaggcgaacttcatattatagggatagatcctttatga |
33489275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University