View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_high_24 (Length: 260)
Name: NF17112_high_24
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 58 - 242
Target Start/End: Original strand, 53233033 - 53233217
Alignment:
| Q |
58 |
ggaactttgagttagtacagtgtcagtcagcaacagctatctctcatgaactattatgactgtaaataaagactagtccttctcttcttctgattctatt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53233033 |
ggaactttgagttagtacagtgtcagtcagcaacagctatctctcatgaactattatgactgtaaataaagactagtccttctcttcttctgattctatt |
53233132 |
T |
 |
| Q |
158 |
gcgttgcatgctaagactaataacaccatcactacatcactgtccttccttcaacactttcatcatcatcattcattattattat |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53233133 |
gcgttgcatgctaagactaacaacaccatcactacatcactgtccttccttgaacactttcatcatcatcattcattattattat |
53233217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University