View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_high_26 (Length: 240)
Name: NF17112_high_26
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 222
Target Start/End: Original strand, 36119758 - 36119958
Alignment:
| Q |
22 |
cccaccgttgccgttgagcaccccatggtgtatgatccggctgccgtcggataatatgacctaattacgtctacatgcaccttcagtggagtgcacatcc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36119758 |
cccaccgttgccgttgagcaccccatggtgtatgatccggctgccgtcggataatatgacctaattacgtctatatgcaccttcagtggagtgcacatcc |
36119857 |
T |
 |
| Q |
122 |
caattttgtgttacatttatctaaaacagaaactaccctataatgcatgttatctaccttccaacacaccaaattagttctctggtctcccttgaatcca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36119858 |
caattttgtgttacatttatctaaaacagaaactaccctataatgcatgttatctaccttccaaaacaccaaattagttctctggtctcccttgaatcca |
36119957 |
T |
 |
| Q |
222 |
t |
222 |
Q |
| |
|
| |
|
|
| T |
36119958 |
t |
36119958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University