View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_low_21 (Length: 349)
Name: NF17112_low_21
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 11262780 - 11262980
Alignment:
| Q |
16 |
agtttttcatgatagatggctagcaaatggagctttggtgcaaccttcaataatatatatgcatagtacaaattttgatctttaagctttattgagaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262780 |
agtttttcatgatagatggctagcaaatggagctttggtgcaaccttcaataatatatatgcatagtacaaattttgatctttaagctttattgagaaat |
11262879 |
T |
 |
| Q |
116 |
gactgcaaagaatggaacatagagatgttgcaattgtactaacccacaatctttcgttgaggttatttgaacacctatctttaatatttctgcaatgcat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262880 |
gactgcaaagaatggaacatagagatgttgcaattatactaacccacaatctttcattgagtttatttgaacacctatctttaatatttctgcaatgcat |
11262979 |
T |
 |
| Q |
216 |
g |
216 |
Q |
| |
|
| |
|
|
| T |
11262980 |
g |
11262980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 244 - 339
Target Start/End: Original strand, 11262974 - 11263070
Alignment:
| Q |
244 |
atgcatggt-agtatctgcttgaatgagcttgtagaaagtgcaacattgagagtagaagctaattggaaggtcttatggaaaatgatagtactacct |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11262974 |
atgcatggtgagtatctgcttgaatgagcttgtagaaagtgcaacattgagagtagaagctaattggaaggtcttatggaaaatgatagtactacct |
11263070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University