View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_low_24 (Length: 280)
Name: NF17112_low_24
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 31077151 - 31077401
Alignment:
| Q |
1 |
tcaagtttattttacgttctgattatctttcgttttatctttcttgttgttaccaacagcggtatgtaattttttgcaccattttaaagtttcaatttta |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
31077151 |
tcaagtttattttatgttctgatcatctttcgttttatctttcttgttaccaccaacagcggtatgtcatttt-tgcaccattttaaagtttgaatttta |
31077249 |
T |
|
| Q |
101 |
tcttatacacaatatttcatcatgttttagtaaaacttgtttgttcttatttaacagcagtttccatcctttgcaaaagaaactctcattgtccaaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31077250 |
tcttatacacaatatttcatcatgttttagtaaaacttgtttgttcttatttaacagcagtttccatcctttgcaaaagaaactctcattgtccaaaata |
31077349 |
T |
|
| Q |
201 |
tatgtgctcccctcctttacaccaagagtgcattaggaatatgtgcatgtgt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31077350 |
tatgtgctcccctcctttacaccaagagtgcattaggaatatgtgcatgtgt |
31077401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University