View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17112_low_30 (Length: 214)
Name: NF17112_low_30
Description: NF17112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17112_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 8496574 - 8496386
Alignment:
| Q |
16 |
cacaaagtggcaatgatctcgagnnnnnnnnctattataagagttgtttgactttttatgcagaggatgaaggagctcttggtgagattgaggaagcaca |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496574 |
cacaaagtggcaatgatctcgagaaaaaaaactattataagagttgtttgactttttatgcagaggatgaaggagctcttggtgagattgaggaagcaca |
8496475 |
T |
 |
| Q |
116 |
agacctcttgaaccgttctgattacaatggtgttaatgtgcatatcagtggtgtcatgagcgatgtttataactgccgtactgatgatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
8496474 |
agacctcttgaaccgttctgattacaatggtgttaatgtgcatatcagtggtgtcatgagcgatgtttataactgcggtactggtgatg |
8496386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University