View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17114_low_9 (Length: 254)
Name: NF17114_low_9
Description: NF17114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17114_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 3 - 239
Target Start/End: Original strand, 48642628 - 48642869
Alignment:
| Q |
3 |
aaagagattaaaacgtgaaaagagaaaaaatatgtattttagcagaagagctcatactgctgattttcatgcataagtgtcaaggtttttgtcaactgta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48642628 |
aaagagattaaaacgtgaaaagagaaaaaatatgtattttagcagaagagctcatactgctgattttcatgcataagtgtcaaggtttttgtcaactgta |
48642727 |
T |
|
| Q |
103 |
acaaaaaatctgaagtgattactgtttacaacataataagt-----ttgtaagtgtttacatccccttaccagatgctcttccagcaaaacaatggagct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48642728 |
acaaaaaatctgaagtgattactgtttacaacataataagtttgtattgtaagtgtttacatccccttaccagatgctcttccagcaaaacaatggagct |
48642827 |
T |
|
| Q |
198 |
tgtgaaagttttggctgcactgcatcctgcagttttactact |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48642828 |
tgtgaaagttttggctgcactgcatcctgcagttttactact |
48642869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University