View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17115_low_8 (Length: 236)
Name: NF17115_low_8
Description: NF17115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17115_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 2 - 97
Target Start/End: Original strand, 614867 - 614964
Alignment:
| Q |
2 |
tattattggagatgttcttataaaatttcgtttgttcatnnnnnnnnnn--tatactcaacttttcttttcaagagattaaatagaaccggatttgga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
614867 |
tattattggagatgttcttataaaatttcgtttgttcataaaaaaataaaatatactcaacttttcttttcaagagattaaatagaatcggatttgga |
614964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 615043 - 615087
Alignment:
| Q |
176 |
aaatattattatctatttcatttccttcaatttttggctaaattc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
615043 |
aaatattattatctatttcatttccttcaatttttggctaaattc |
615087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University