View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17116_low_11 (Length: 252)
Name: NF17116_low_11
Description: NF17116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17116_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 363076 - 362903
Alignment:
| Q |
11 |
agaaaatgtatgattagtttatatgttatgattttaaatctttatgattacaaatattagtagattcctatctatagaggcgcgtggnnnnnnnntatca |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
363076 |
agaaaaggtatgattagtttatatgttatgattttaaatctttatgattacaaatattagtagattcctatctatagaggcgcgtgg-aaaaaaatatca |
362978 |
T |
|
| Q |
111 |
atatgcttcatcaattgattattattgaaataagttatgttttcctattaatttcataatgtatgatattataac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
362977 |
atatgcttcatcaattgattattattgaaataagttatgttttcctattaatttcataatgtatgatattataac |
362903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 362891 - 362857
Alignment:
| Q |
202 |
gctttgtgaacagtgttggttccaaagagcatgat |
236 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
362891 |
gctttgtgaacagtgtaggttccaaagagcatgat |
362857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University