View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17116_low_9 (Length: 270)
Name: NF17116_low_9
Description: NF17116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17116_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 3 - 178
Target Start/End: Complemental strand, 32959904 - 32959729
Alignment:
| Q |
3 |
gagtgagatgaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtc |
102 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959904 |
gagtgaaaagaaggagaaaaaatatgatagaaatgtacttacaatcttgcatgaaccaagttgaagaagaccatgtccagcttgaattacagctatggtc |
32959805 |
T |
 |
| Q |
103 |
tgctcatggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959804 |
tgctcatggaaacaaataaaatgagttgaaaaatcttaagaaatcaattaatccttgtgagaccaataataatagc |
32959729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University