View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_29 (Length: 445)
Name: NF17117_high_29
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 71 - 412
Target Start/End: Original strand, 37098646 - 37098987
Alignment:
| Q |
71 |
acaccatttccatcactctccgcagcagcaacatcaagaatcctctcaaacaccttcaacaaagcctcctgtgggtttaaagaaacatctccatcgccgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37098646 |
acaccatttccatcactctccgcagcagcaacatcaagaatcctctcaaacaccttcaacaaagcctcctgtgggtttaaagaaacatctccatcgccgt |
37098745 |
T |
 |
| Q |
171 |
tgagattaacgatgacaacgataacacgctccggacagtcgaccggcgcgtcgtcgattcggatcctagctccggtgagttgttgaagggatttgatgac |
270 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37098746 |
tgagattaacgatgacaacgatgacacgctccggacagtcgaccggcgcgtcgtcgattcggatcctagctccggtgagttgttgaagggatttgatgac |
37098845 |
T |
 |
| Q |
271 |
ggagccggattttccgatgaaagcgccgatacgtgacgcgtggcagaggagacggaagacgacgtggccgttattgcgcttgaaagtagtgaatgatgat |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37098846 |
ggagccggattttccgatgaaagcgccgatacgtgacgcgtggcagaggagacggaagacgacgtggccgttattgcgcttgaaggtagtgaatgatgat |
37098945 |
T |
 |
| Q |
371 |
tcttcagtgttgcttcccatagtgattgatgataattttcag |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37098946 |
tcttcagtgttgcttcccatagtgattgatgatagttttcag |
37098987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University