View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_high_41 (Length: 386)

Name: NF17117_high_41
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_high_41
NF17117_high_41
[»] chr5 (1 HSPs)
chr5 (22-226)||(36822837-36823046)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 36823046 - 36822837
Alignment:
22 atgacatgaaactatttaaacccagacttttttgcttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaa 121  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36823046 atgacatgaaactatttaaacccagactttttt-cttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaa 36822948  T
122 cccttcaaagatccgaataaactaattgatttacaaaatagatag------aatgcttcgaccataacagggtaacacgttacccgcaagcccttttcct 215  Q
    |||||||||||||||||||||| ||||||||||||| |||||  |       ||||||||||||||||||||||||||||||||||||||||||||||||    
36822947 cccttcaaagatccgaataaacaaattgatttacaagatagaatgctaccccatgcttcgaccataacagggtaacacgttacccgcaagcccttttcct 36822848  T
216 ccaacccaacc 226  Q
    |||||||||||    
36822847 ccaacccaacc 36822837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University