View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_43 (Length: 376)
Name: NF17117_high_43
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 41463737 - 41464067
Alignment:
| Q |
1 |
tccatataaggtagattaaggagtgtttggnnnnnnncactttcattgcataatactttgaacccagggtatccacatgtatttgtttgtttttcttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41463737 |
tccatataaggtagattaaggagtgtttgatttttttcactttcattgcataatactttgaacccagggtatccacatgtatttgtttgtttttcttcta |
41463836 |
T |
|
| Q |
101 |
tatggaacgggaatcggattagtggttcattcatgtggcaaacagtgtctaagcatgtttcaatggttgccagtgacattacttgtgtttgattaaggtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41463837 |
tatggaacgggaatcggattagtggttcattcatgtggcaaacagtgtctaagcatgtttctatggttgctagtgacattacttgtgtttgattaaggtt |
41463936 |
T |
|
| Q |
201 |
gaagaggaaaaggaaacaaattaggatgagtttgggattgggagtcttcatgtttgtcaacggattttgggtttgtctaaattattggtatttggtattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41463937 |
gaagaggaaaaggaaacaaattaggatgagtttgggattgggagtcttcatgtttgtcaacggattttgggtttgtctaaattattggtatttggtattg |
41464036 |
T |
|
| Q |
301 |
tcaccaatagtgacattaatcttgccaaata |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41464037 |
tcaccaatagtgacattaatcttgccaaata |
41464067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University