View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_52 (Length: 325)
Name: NF17117_high_52
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 99 - 314
Target Start/End: Original strand, 1428191 - 1428410
Alignment:
| Q |
99 |
tacaaatggtgaatctagggttcaaggaaaatcgagaacagtgtaaagagtgaaagagaaattagggttacat-accgagggaggaagtgaatgacactg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1428191 |
tacaaatggtgaatctagggttcaaggaaaaacgaaaacagtgtaaagagtgaaagagaaattagggttacattaccgagggaggaagtgaatgacactg |
1428290 |
T |
 |
| Q |
198 |
caaatgcaaagggttttcgctgcgggaaggtttgtgaata---agtagggttttgtagttatgggcttatcacaaatagtgaggtgtaagcccgattatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1428291 |
caaatgcaaagggttttcgctgcgggaaggtttgtgaatataaagtagggttttgtagttatgggcttatcacaaatagtgaggtgtaagcccgattatt |
1428390 |
T |
 |
| Q |
295 |
tagatccattgttttttctt |
314 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1428391 |
tagatccattgttttttctt |
1428410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 1424991 - 1425027
Alignment:
| Q |
142 |
taaagagtgaaagagaaattagggttacataccgagg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1424991 |
taaagagtgaaagagaaattagggttacataccgagg |
1425027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 1428091 - 1428125
Alignment:
| Q |
1 |
ttcacttcttcacccatctctgttattcattaccc |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1428091 |
ttcacttcttcacccatctctgtgattcattaccc |
1428125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University