View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_64 (Length: 293)
Name: NF17117_high_64
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 53661139 - 53660876
Alignment:
| Q |
18 |
catttgagaatcttattcaaaaatcacacactcacattctttggtatgagtgaacttggttgcttcaagaagagcggaagcctcgccttcaagcaacgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661139 |
catttgagaatcttattcaaaaatcacacactcacattctttggtacgagtgaacttggttgcttcaagaagagcggaagcctcgccttcaagcaacgac |
53661040 |
T |
 |
| Q |
118 |
atatggccatgtctccatnnnnnnnnnnnnnnnnncatgtgccgtcatgaatcaaccatcagaatcatgagcacaacatccaaaagaagtggacctatct |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53661039 |
atatggccatgtctccattgtgtgtgtgtgtgtgtcatgtgccgtcatgaatcaaccatcagaatcatgagcgcaacatccaaaagaagtggacctatct |
53660940 |
T |
 |
| Q |
218 |
tcctgttggaaatccacatccacgttgcacttaagccatatatacgttggtctttcctatgcta |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660939 |
tcctgttggaaatccacatccatgttgcacttaagccatatatacgttggtctttcctatgcta |
53660876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 10244879 - 10244932
Alignment:
| Q |
67 |
gtgaacttggttgcttcaagaagagcggaagcctcgccttcaagcaacgacata |
120 |
Q |
| |
|
|||||| || |||||||||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
10244879 |
gtgaacctgattgcttcaagaagagctgaagcttcgccttcaagcaccgacata |
10244932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University