View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_67 (Length: 289)
Name: NF17117_high_67
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_67 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 43310709 - 43310546
Alignment:
| Q |
21 |
aggtgactttgttgatgttttgctttggatccaaaggacagaatccctaggttttcctattgacagaacagtcatcaaggccctgttattggtaagtgta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43310709 |
aggtgactttgttgatgttttgctttggatccaaaggacagaatccctaggttttcctattgacaaaacagtcattaaggccctgttattggtaagtgta |
43310610 |
T |
 |
| Q |
121 |
aaactaaaatctttatattttgtggagcttaagacatgcatacaaatgttttattacttcatac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43310609 |
aaactaaaatctttatattttgtggagcttaagacatgcatacaaatgttttattacttcatac |
43310546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 43268142 - 43268034
Alignment:
| Q |
24 |
tgactttgttgatgttttgctttggatccaaaggacagaatccctaggttttcctattgacagaacagtcatcaaggccctgttattggtaagtgtaaaa |
123 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| || || ||||||||||||| ||| ||||| ||||| || || ||||| |||||||| |
|
|
| T |
43268142 |
tgactttgttgaagttttgctttggatccaaagaacagaatcacttggctttcctattgacaaaacggtcataaaggctctactactggtatgtgtaaaa |
43268043 |
T |
 |
| Q |
124 |
ctaaaatct |
132 |
Q |
| |
|
||||||||| |
|
|
| T |
43268042 |
ctaaaatct |
43268034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 43275032 - 43274924
Alignment:
| Q |
24 |
tgactttgttgatgttttgctttggatccaaaggacagaatccctaggttttcctattgacagaacagtcatcaaggccctgttattggtaagtgtaaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| || || ||||||||||| |||||| | || || || || ||||||||||||||||| |
|
|
| T |
43275032 |
tgactttgttgatgttttgctttggatccaaaagacagaatcacttggctttcctattgatagaacaattataaaagctctcctattggtaagtgtaaaa |
43274933 |
T |
 |
| Q |
124 |
ctaaaatct |
132 |
Q |
| |
|
|||||||| |
|
|
| T |
43274932 |
ttaaaatct |
43274924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 60
Target Start/End: Complemental strand, 92198 - 92166
Alignment:
| Q |
28 |
tttgttgatgttttgctttggatccaaaggaca |
60 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
92198 |
tttgtggatgttttgctttggatccaaaggaca |
92166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University