View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_84 (Length: 248)
Name: NF17117_high_84
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_84 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 41170896 - 41171133
Alignment:
| Q |
9 |
gataatactatgctttgtgcataactttttgatagtgctccaggtccgatggttttagtggtaactttttgggatattatttctacgtatgttaagctgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170896 |
gataatactatgctttgtgcataactttttgatagtgctccaggtccgatggttttagtggtaactttttgggatattatttctacgtatgttaagctgc |
41170995 |
T |
 |
| Q |
109 |
tgaataacatcaattccaacatgttggtgttaatccctgaaaagccaggatatatgatgctttgcaagattttcgtccctttaggttggctgctatttgc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170996 |
tgaataacatcaattccaacatgttggtgttaatccctgaaaagccagg--atatgatgctttgcaagattttcgtccctttaggttggctgctatttgc |
41171093 |
T |
 |
| Q |
209 |
tcctaaggtttcgttccatggaaggaaaatttctgactgt |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41171094 |
tcctaaggtttcgttccaaggaaggaaaatttctgactgt |
41171133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University