View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_86 (Length: 245)
Name: NF17117_high_86
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 11 - 122
Target Start/End: Original strand, 24546842 - 24546952
Alignment:
| Q |
11 |
ttattcttctcttgatatttt-ttcttcctattgtcgtaagttgaaatatagaatctacaatgtttttcttttcctccctatatagaggttctcatcaat |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24546842 |
ttattcttctcttgatatttttttcttcctattgtcgtaagttgaaatatagaatctacaatgtttttcttttcctccctatat--aggttctcatcaat |
24546939 |
T |
|
| Q |
110 |
gtgctgctcattt |
122 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24546940 |
gtgctgctcattt |
24546952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 162 - 229
Target Start/End: Original strand, 24547671 - 24547738
Alignment:
| Q |
162 |
acgaaaaaagcaaagcatttcctttccattagcaccttccactttaaatcacttgtcaggtcaatatt |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24547671 |
acgaaaaaagcaaagcatttccttcccattagcaccttccactttaaatcacttgtcaggtcaatatt |
24547738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University