View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_87 (Length: 244)
Name: NF17117_high_87
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 45669112 - 45669347
Alignment:
| Q |
1 |
cgagaaggtgttaaggtcattgattgtccttacccttgtgataatacatgtcaccatttggttttcagttgagccaaagttcatacgtcatcatcatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45669112 |
cgagaaggtgttaaggtcattgattgtccttacccttgtgataatacatgtcaccatttggttttcagttgagccaaagttcatacatcatcatcatcaa |
45669211 |
T |
 |
| Q |
101 |
tggaggattatgctattcaattaatattatgttacacaaaatgcaaatttgatctgtcaaaattaacttgctttgatagtcattgatgacattgaaagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
45669212 |
tggaggattatgctattcaattaatattatgttacacaaaatgcaaatttgatctgtcaaaattaacttgctttgatagtcattggtgaaattgaaagtg |
45669311 |
T |
 |
| Q |
201 |
tctttaactatttgggaatgctgaggcaagtcctct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45669312 |
tctttaactatttgggaatgctgaggcaagtcctct |
45669347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 37970958 - 37970890
Alignment:
| Q |
10 |
gttaaggtcattgattgtccttacccttgtgataatacatgtcaccatttggttttcagttgagccaaa |
78 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
37970958 |
gttaaggacattgattgtccttacccttgtgataacacatgccaccatttggttttcagatgagccaaa |
37970890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University