View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_90 (Length: 233)
Name: NF17117_high_90
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 14201455 - 14201658
Alignment:
| Q |
18 |
gaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatcatgataggttcgggttcggatgtggattgagaatggttcagtttaggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14201455 |
gaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatcatgataggttcgggttcggatgtggattgagaaaggttcagtttaggt |
14201554 |
T |
 |
| Q |
118 |
ttggatgatgattgtgtctgtgagttgagtgaactgtatatgaaggagaaaacaggggaaggtgctgtggattttggtatggcgccttcaaatctatctg |
217 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14201555 |
ttggatgatgattgggtctatgagttgagtaaactgtatatgaaggagaaaacaggggaaggtgctgtggattttggtatggcgccttcaaatctatttg |
14201654 |
T |
 |
| Q |
218 |
tgct |
221 |
Q |
| |
|
|||| |
|
|
| T |
14201655 |
tgct |
14201658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University