View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_91 (Length: 233)
Name: NF17117_high_91
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 37862634 - 37862431
Alignment:
| Q |
17 |
aaaatactagcatgtatagaaactaagatcatcgatgatccatggctagaagtctctcg-tggtaatgatcgtaaaacacaaataaaaacgggtaatgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37862634 |
aaaatactagcatgtatagaaactaagatcatcaatgatccatggctagaagtctctcgatggtaatgatcgtaaaacacaaataaaaacgggtaatgaa |
37862535 |
T |
 |
| Q |
116 |
catatattgtcttgtagttctttctcgacgaatattgtttatgtcttagacactcttcaggtgagcataaaagacaatatatgttatatattgacatcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37862534 |
catatattgtcttgtagttctttctcgacgaatattgtttatgtcttagacactcttcaggtgagcataaaagacaatatatgttatatattgacatcat |
37862435 |
T |
 |
| Q |
216 |
aagt |
219 |
Q |
| |
|
|||| |
|
|
| T |
37862434 |
aagt |
37862431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University