View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_high_93 (Length: 223)
Name: NF17117_high_93
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_high_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 48155779 - 48155972
Alignment:
| Q |
16 |
ttgttgtcttcattgcaacgaaatttatatcaccgaatttggcaatattattagtaactgcagattttaatttt-ttacttattttaaaaaatctcatgt |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48155779 |
ttgttgtcttcattgcaacaaaatttataacaccgaatttggcaatattattagtaactgcagattttaatttttttacttattttaaaaaatctcatgt |
48155878 |
T |
 |
| Q |
115 |
tgaatttgttaggagacaaacaaatgaacaaactcacattcttgcatgttgcataggtagccatagcccatagctagtttccaattatgaattaatattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48155879 |
tgaatttgttaggagacaaacaaatgaacaaactcacattcttgcatgttgcataggtag-------ccatagctagtttccaattatgaattaatattc |
48155971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University