View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_42 (Length: 386)
Name: NF17117_low_42
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 36823046 - 36822837
Alignment:
| Q |
22 |
atgacatgaaactatttaaacccagacttttttgcttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823046 |
atgacatgaaactatttaaacccagactttttt-cttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaa |
36822948 |
T |
 |
| Q |
122 |
cccttcaaagatccgaataaactaattgatttacaaaatagatag------aatgcttcgaccataacagggtaacacgttacccgcaagcccttttcct |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36822947 |
cccttcaaagatccgaataaacaaattgatttacaagatagaatgctaccccatgcttcgaccataacagggtaacacgttacccgcaagcccttttcct |
36822848 |
T |
 |
| Q |
216 |
ccaacccaacc |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
36822847 |
ccaacccaacc |
36822837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University