View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_58 (Length: 304)
Name: NF17117_low_58
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 294
Target Start/End: Original strand, 47685311 - 47685592
Alignment:
| Q |
18 |
attcaaagcaaagctttagtcaacatagtatacatacaacttgctggcatctttttctgcttcctgggggcccttttgtgctcagcagtagaacagcaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47685311 |
attcaaagcaaagctttagtcaacatagtttacatacaacttgctggcatctttctctgcttcctgggggcccttttgtgctcagcagtagaacagcaca |
47685410 |
T |
|
| Q |
118 |
gccttgtttgtgggtcttcattcattcattcaagtgaagtgaattgtactcctttatttattactattatattatatacctacctgctttac-----tct |
212 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47685411 |
gctttgtttgtgggtcttcattcattcattcaagtgaagtgaagtgtactcctttatttattactattatattatatacctacctgctttactctcttct |
47685510 |
T |
|
| Q |
213 |
cttcactttacttgtcagtttctgctatatacctgcacttgctaggtagatgctctagctaatccttagtggctgccctatg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47685511 |
cttcactttacttgtcagtttctgctatatacctgcacttgctaggtagatgctctagctaatccttagtggctgccttatg |
47685592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 155 - 225
Target Start/End: Original strand, 10561576 - 10561646
Alignment:
| Q |
155 |
agtgaattgtactcctttatttattactattatattatatacctacctgctttactctcttcactttactt |
225 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
10561576 |
agtgaagtgtactcctttatttataactattatattatatacctacctgctttactctcttctcttcactt |
10561646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 155 - 234
Target Start/End: Original strand, 14499019 - 14499103
Alignment:
| Q |
155 |
agtgaattgtactcctttatttattactattatattatatacctacctgctttac-----tctcttcactttacttgtcagtttc |
234 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
14499019 |
agtgaagtgtactcctttatttataactattatattatatacctacatgttttactctcttctcttcactttacttgtcagtttc |
14499103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University