View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_61 (Length: 300)
Name: NF17117_low_61
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_61 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 300
Target Start/End: Complemental strand, 54534867 - 54534578
Alignment:
| Q |
11 |
catagggtggggtcggtggtatagtttgaaggaattggagaatgcgacggatggatttgcggaagggagcgtgatcggagaaggaggatatggaattgta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54534867 |
catagggtggggtcggtggtatagtttgaaggaattggagaatgcgacggatggatttgcggaagggagcgtgatcggagaaggaggatatggaattgta |
54534768 |
T |
 |
| Q |
111 |
tacagaggaattcttcaagatggttctattgtcgctgtcaagaatcttctcaacaataagtatgttgttgctaattaaatcacattttccatttcattct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54534767 |
tacagaggaattcttcaagatggttctattgtcgctgtcaagaatcttctcaacaataagtatgttgttgctaattaaatcacattttccatttcattct |
54534668 |
T |
 |
| Q |
211 |
tatactttagtaaaacttcgatttggtctctcaccgttttttcgctgctataataagggtaataagagacaaacttagataatctttttc |
300 |
Q |
| |
|
||||||| ||||||| || |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54534667 |
tatacttcagtaaaaatttgatttggtctcttaccgttttctcgctgctataataatggtaataagagacaaacttagataatctttttc |
54534578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 178
Target Start/End: Complemental strand, 26327683 - 26327517
Alignment:
| Q |
12 |
atagggtggggtcggtggtatagtttgaaggaattggagaatgcgacggatggatttgcggaagggagcgtgatcggagaaggaggatatggaattgtat |
111 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||| | ||||| |||||||| |||||||| || || |||||||| || ||||| |||| | |
|
|
| T |
26327683 |
atagggtggggtaggtggtatagtctgaaggaagtggaaatggcgacacgtggatttgaggaagggaatgttattggagaaggtgggtatggggttgtgt |
26327584 |
T |
 |
| Q |
112 |
acagaggaattcttcaagatggttctattgtcgctgtcaagaatcttctcaacaataagtatgttgt |
178 |
Q |
| |
|
| ||||| || | |||||||||| | |||| || ||||||||||||| ||| || ||||||||||| |
|
|
| T |
26327583 |
atagaggtgttttgcaagatggttgtgttgtggcagtcaagaatcttcacaataacaagtatgttgt |
26327517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University