View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_64 (Length: 297)
Name: NF17117_low_64
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 297
Target Start/End: Original strand, 16271601 - 16271863
Alignment:
| Q |
12 |
aagcaaaggtatagaataatatatataaagaacaaattgtagaatacggtgttgatagtaattcagtaacgggactgcaaaccacataattactgtttat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16271601 |
aagcaaaggtatagaataatatatataaagaacaaattgtagaatacggtgttgatagtaat---------------------acataattactgtttat |
16271679 |
T |
 |
| Q |
112 |
ttaacctatgaaaagtccaatatttatttaaatgaaaattttctcataggcccctccatttgctctcaggcccttcgaaatgataaaaaatacccccctc |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16271680 |
ttaacctatgaaa-gtccaatatttatttaaatgaaaattttctcataggcccctccatttgctctcaggcccttcgaaatgataaaa-atacccccctc |
16271777 |
T |
 |
| Q |
212 |
atgagttagaattcgaacccaagtactctaacttccactctctcaagtttgaagcgtaattcttgcattgcttttacttatatatc |
297 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16271778 |
atgagttacaattcgaacccaagtgctgtaacttccactctctcaagttcgaatcgtaattcttgcattgcttttacttatatatc |
16271863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University