View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_67 (Length: 292)
Name: NF17117_low_67
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 40593424 - 40593165
Alignment:
| Q |
20 |
ctttgataaattagtaacgctttatttatttactaatacaattattacacgtttagttaattattacacattgtttaggttaagtctattgtggataaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40593424 |
ctttgataaattagtaacgctttatttatttactaatacaattattacacgtttagttaattattacacattgtttaggttaagtctactgtggataaat |
40593325 |
T |
|
| Q |
120 |
aagatagtgcttattttctatcattatatcttccttgatccaaccctggaacttattgatttaatagtgaaaatatacatgttcatggtactacaccgac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40593324 |
aagatagtgcttattttctatcattatatcttccttgatccaaccctggaacttattgatttaatagtgaaaatatacatgttcgtggtactacaccgac |
40593225 |
T |
|
| Q |
220 |
ctcattagcttgtgcagaacaaaagtaacttacaacttattgcatatatatcttcatctc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40593224 |
ctcattagcttgtgcagaacaaaagtaacttacaacttattgcatatatatcttcttctc |
40593165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University