View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_80 (Length: 253)
Name: NF17117_low_80
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 45641185 - 45641409
Alignment:
| Q |
13 |
gagtagcataggtaaggtggtgattattcaaggtgagggtcataatagtactactactcgaaatggatttggttgcaagttttgtttttcgcgtccaaat |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641185 |
gagtagcagaggtaaggtggtgattattcaaggtgagggtcataatagtactactactcgaaatggatttggttgcaagttttgtttttcgcgtccaaat |
45641284 |
T |
 |
| Q |
113 |
gtattggaaaaccctaatgggtcaactggtagtgaccctaatgatcctaaatttactcattctatgttgaagagtttattagagaagaatgatttttgtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45641285 |
gtattggaaaaccctaatgggtcaactagtagtgaccctaatgatcctaaatttactcattctatgttgaagagtttattagagaagaatgatttttgtt |
45641384 |
T |
 |
| Q |
213 |
ccaaagaatgcaatccacatattga |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45641385 |
ccaaagaatgcaatccacatattga |
45641409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University