View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_82 (Length: 252)
Name: NF17117_low_82
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 52767002 - 52767208
Alignment:
| Q |
15 |
cacagaggaattaaagctaaaaccataa-gcatcgagtctttctcaagctataaattatttcagtttttgtctttggctatcttgacagctctcattgcc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52767002 |
cacaaaggaattaaagctaaaaccataaagcatcgagtctttctcaagctataaattatttcagtttttgtctttggctatcttaacagctctcattgcc |
52767101 |
T |
|
| Q |
114 |
cccaaagagctaagcgtttagagagttactaattcccaagtattatgcnnnnnnncctaaaaattgaccaaacttgatccttaaattacctccaaaagct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52767102 |
cccaaagagctaagcgtttagagagttactaatgcccaagtattatgcaaaaaaacctaaaaattgaccaaacttgattcttaaattacctccaaaagct |
52767201 |
T |
|
| Q |
214 |
gaggcac |
220 |
Q |
| |
|
||||||| |
|
|
| T |
52767202 |
gaggcac |
52767208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University