View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17117_low_84 (Length: 249)
Name: NF17117_low_84
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17117_low_84 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 23495937 - 23495699
Alignment:
| Q |
11 |
atgaatcattatttgatataggacttgtttattatcacatgtctgcttgagcatcttcattggtgaaaagggaggttattacatgtctacatctacatca |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23495937 |
atgaatcagtatttgatataggacttgtttattattacatgtctgcttaagcatcttcattggtgaaaagggaggttattacatgtctacatctacatca |
23495838 |
T |
 |
| Q |
111 |
aatgtaatattattggctctgatgagtgagnnnnnnntgcaaagaacaaaactctcgtatcgttctcacggctagaatccatgttaacataatccaattg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23495837 |
aatgtaatattattggctctgatgagtgaaaaaaaaatgcaaagaacaaaactctcgtatcgttctcacggctagaatccatgttaacatgctccaattg |
23495738 |
T |
 |
| Q |
211 |
tataactcaggaataatcgattcttaaatctaagaactc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23495737 |
tataactcaggaataatcgattcttaaatctaagaactc |
23495699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University