View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_low_91 (Length: 233)

Name: NF17117_low_91
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_low_91
NF17117_low_91
[»] chr5 (1 HSPs)
chr5 (18-221)||(14201455-14201658)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 14201455 - 14201658
Alignment:
18 gaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatcatgataggttcgggttcggatgtggattgagaatggttcagtttaggt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
14201455 gaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatcatgataggttcgggttcggatgtggattgagaaaggttcagtttaggt 14201554  T
118 ttggatgatgattgtgtctgtgagttgagtgaactgtatatgaaggagaaaacaggggaaggtgctgtggattttggtatggcgccttcaaatctatctg 217  Q
    |||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
14201555 ttggatgatgattgggtctatgagttgagtaaactgtatatgaaggagaaaacaggggaaggtgctgtggattttggtatggcgccttcaaatctatttg 14201654  T
218 tgct 221  Q
    ||||    
14201655 tgct 14201658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University