View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17117_low_99 (Length: 213)

Name: NF17117_low_99
Description: NF17117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17117_low_99
NF17117_low_99
[»] chr3 (1 HSPs)
chr3 (13-195)||(32764629-32764811)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 32764629 - 32764811
Alignment:
13 gagatgaaaataataatcaacccactcaaccttttgttccaggttcttggtcatctttgttccatagccatcaaatttaccactagatggatcatttgca 112  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32764629 gagatgaaaataataatcaacccactcaaccttttgttcaaggttcttggtcatctttgttccatagccatcaaatttaccactagatggatcatttgca 32764728  T
113 tatgtctctttctccttttgagggagagnnnnnnnctcctggcccacatcttgcaaactttgaataagtttttgagatatacc 195  Q
    ||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||    
32764729 tatgtctctttctccttttgagggagagaaaaaaactcctggcccacatcttgcaaactttgaataagtttttgagatatacc 32764811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University