View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17118_high_2 (Length: 305)
Name: NF17118_high_2
Description: NF17118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17118_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 169 - 290
Target Start/End: Complemental strand, 31397110 - 31396989
Alignment:
| Q |
169 |
tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgattgttgctcttcgagcctacttgcttttnnnnnnnnnnnnntcactaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31397110 |
tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgattgttgctcttcgagcctacttgcttttaaaaaataaaaaatcactaa |
31397011 |
T |
|
| Q |
269 |
aagtaccgcaagttatattttg |
290 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31397010 |
aagtaccgcaagttatattttg |
31396989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 31397191 - 31397115
Alignment:
| Q |
10 |
catcatcatatcatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagagaccaaaat |
86 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31397191 |
catcatcatattatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagaaacctaaat |
31397115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University