View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17118_low_1 (Length: 383)
Name: NF17118_low_1
Description: NF17118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17118_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 3 - 196
Target Start/End: Original strand, 12616451 - 12616644
Alignment:
| Q |
3 |
gtttagaaagaagacagaatatgggtttgagataggttattgtgttggtaaattatagtttatactatataatattataacaagaaaaatagagaggaag |
102 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616451 |
gtttagaaagaagacaaaatatgggtttgagataggttattgtgttggtaaattatagtttatgctatataatattataacaagaaaaatagagaggaag |
12616550 |
T |
 |
| Q |
103 |
ggacgaagagggagacgaaaagagagaatatgtgaaagatgatgaggagaagtaatgtaggaaaataaccaaaataatgggatatttatgcagg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12616551 |
ggacgaagagggagacgaaaagagagaatatgtgaaagatgatgaggggaagtaatgtaggaaaataacgaaaataatgggatatttatgcagg |
12616644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University