View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_100 (Length: 226)
Name: NF1711_high_100
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_high_100 |
![](./plan/images/spacer.gif) | ![NF1711_high_100](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 211
Target Start/End: Original strand, 30363238 - 30363443
Alignment:
Q |
6 |
agttttggtatttgtggataccttcttagagttctgttgcttcttagaaatagtggaaggggcattgacactttttcgcaatgctggttttggtgtgcaa |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30363238 |
agttttggtatttgtggataccttcttagagttctgttgcttcttagaattagtggaagtggcattgacactttttcgcaatgctggttttggtgtgcaa |
30363337 |
T |
![](./plan/images/spacer.gif) |
Q |
106 |
gcatcttttcctacttcaacagatgatccccttgtggatgttgctgtgtttaagatctcccctttactcattttcttaccaacaccatcctgatagatag |
205 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30363338 |
gcatcttttcctacttcaacagatgctccccttgtggatgttgctgtgtttaagatctcccctttactcattttcttaccaacaccatcctgatagatag |
30363437 |
T |
![](./plan/images/spacer.gif) |
Q |
206 |
atagat |
211 |
Q |
|
|
|||||| |
|
|
T |
30363438 |
atagat |
30363443 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25968 times since January 2019
Visitors: 1362