View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_high_26 (Length: 389)
Name: NF1711_high_26
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 374
Target Start/End: Complemental strand, 12365718 - 12365362
Alignment:
| Q |
18 |
aactattgttcaatattttcctaaaattcttgttctggttgagatgcctatctggagctttccccaaattcttgaggattgactgatttgaattgcggtg |
117 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
12365718 |
aactgttgttcaatattttcctgaaagtcttgttctggttgagatgcctgtctagagctttccccaatttcttgaggattgactggtttgaattgcggtg |
12365619 |
T |
 |
| Q |
118 |
gaagattcccatgacttatacaaatagtatcaatttgagtcttttctctgtcttggagattaataaaactgatataatccattaagtctttggtaacctt |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12365618 |
gaagattcccatgacttatacatgtagtatcaatttgagtcttttctctgtgatggagattagtaaaattgatataatccattaagtctttggtaacctt |
12365519 |
T |
 |
| Q |
218 |
taagcttggaggataatcatcaatagtttcccatatatctgcataatttttacaaatgaggaatttagtcctaggatctatgtgatatgatctgtgcaca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
12365518 |
taagcttggaggataatcatcaatagtttcccatatatctgcataatttttacaaataaggaatttagtcctgggatctatctgatatggtctgtgcaca |
12365419 |
T |
 |
| Q |
318 |
gtgaagactgtcttgggtttgccagtagtctctggtgccattcttctttttcttact |
374 |
Q |
| |
|
|| |||||||||||| |||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
12365418 |
gttaagactgtcttgagtttgccaatagcctctggtgccattcctctttttcttact |
12365362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University