View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_108 (Length: 218)
Name: NF1711_low_108
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1711_low_108 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 48 - 205
Target Start/End: Complemental strand, 27245269 - 27245112
Alignment:
Q |
48 |
tggaccaccaatggacaaagacatatcacatatgccaaactaagcagaaactaagccgtaaagaatgtctttaaaacaataattcacttttaaaaatagt |
147 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
T |
27245269 |
tggaccaccaatggacaaagacatatcacatatgccaaactaagcagaaactaagacgtaaagaatgtctttaaaaaaataattcaattttaaaaatagt |
27245170 |
T |
|
Q |
148 |
aaaaatattcctaaacacacatggacatataaattatgtttcttaaaagtaattggta |
205 |
Q |
|
|
||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
27245169 |
aaaaatattcctaaaaacccatggacgtataaattatgtttcttaaaagtaattggta |
27245112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8930 times since January 2019
Visitors: 6055