View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1711_low_20 (Length: 450)
Name: NF1711_low_20
Description: NF1711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1711_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 183 - 433
Target Start/End: Complemental strand, 42010552 - 42010288
Alignment:
| Q |
183 |
tttgacgtaaacaaaaccaaaatgttaaggtcaatgtattgttgggaattaat----cacaaccatagaa-------------agaaagttgcatagcca |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
42010552 |
tttgacgtaaacaaaaccaaaatgttaaggtcaatgtattgttgggaattaattaatcacaaccatagaatgaaaacacgaaaagaaagttgcatagcca |
42010453 |
T |
 |
| Q |
266 |
gttgataaagcaagaagaagatagcataccttgattggagggactagggaaacattcaacttgaagcctatttctattttcatcctcagagaacccacaa |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
42010452 |
gttgataaagcaagaagaagatagcataccttgattggagggactagggaaacattcaacttgaagcctattt---tcatcctcctcagagaacccacaa |
42010356 |
T |
 |
| Q |
366 |
acttgaccatcaagtaaacagtctccacatcgtggtttggtccaaaccaactcaacatcactatcaag |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42010355 |
acttgaccatcaagtaaacagtctccacatcgtggtttggtccaaaccaactcaacatcactttcaag |
42010288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 10 - 117
Target Start/End: Complemental strand, 42010725 - 42010618
Alignment:
| Q |
10 |
atgaagtatagcacggttagtctctttagagggaggcaaatataaattaatttgtcattgcattctagaatgaggaggatccttgtctcaccttaatttt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42010725 |
atgaattatagcacggttagtctctttagagggaggcaaatataaattaatttgtcattgcattctagaatgaggaggatccttgtctcaccttaatttt |
42010626 |
T |
 |
| Q |
110 |
tctttacc |
117 |
Q |
| |
|
|||||||| |
|
|
| T |
42010625 |
tctttacc |
42010618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University